NovoPro
Cart 2
  • BMX Human  cDNA/ORF Clone

BMX Human cDNA/ORF Clone

Cat.#: 714812-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 347.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BMX non-receptor tyrosine kinase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BMX
  • Gene Type
    protein coding
  • Also Known as
    ETK; PSCTK2; PSCTK3
  • Encoded Protein Alias
    cytoplasmic tyrosine-protein kinase BMX; BTK-like on X chromosome; Etk/Bmx cytosolic tyrosine kinase; NTK38 tyrosine kinase; bone marrow tyrosine kinase gene in chromosome X protein; epithelial and endothelial tyrosine kinase
  • Product Name
    BMX(NM_001320866) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens BMX non-receptor tyrosine kinase (BMX), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2025
  • Annotation
    This variant (3) uses an alternate in-frame acceptor splice site in the mid-coding region compared to variant 1. The resulting isoform (2) is 1 aa shorter than isoform 1.
  • siRNA

    GUACCACUCUAGCCCAAUAtt

    GUACCAGUCUAGCGCAAUAtt

    CAGACUAUGAUGAAACUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"