NovoPro
Cart 2
  • Bin1 Mouse  cDNA/ORF Clones

Bin1 Mouse cDNA/ORF Clones

Cat.#: 747960-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 269.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    bridging integrator 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Bin1
  • Gene Type
    protein coding
  • Also Known as
    ALP-1; Amphl; SH3P9; BRAMP-2
  • Encoded Protein Alias
    SH3 domain-containing protein 9; amphiphysin 2; amphiphysin II; amphiphysin-like protein; myc box dependent interacting protein 1
  • Product Name
    Bin1(XM_006525984) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1572
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525980) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1719
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525986) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1479
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(NM_009668) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus bridging integrator 1 (Bin1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1767
  • siRNA

    GCCUUUUUGAUGACGCAUUtt

    GCAACACCUUCACAGUCAAtt

    UGCUGACCAUGGACACCUAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006525991) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    1350
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525993) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1305
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_017317916) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1527
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525995) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    1233
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525981) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1704
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_017317917) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1362
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525992) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    1326
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525983) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1659
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525994) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    1278
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525982) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1674
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525990) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1371
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525985) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1500
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525979) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1797
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525988) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1443
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525989) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    1398
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(NM_001083334) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus bridging integrator 1 (Bin1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1434
  • siRNA

    GCCUUUUUGAUGACGCAUUtt

    GCAACACCUUCACAGUCAAtt

    UGCUGACCAUGGACACCUAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006525987) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1455
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006525978) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus bridging integrator 1 (Bin1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1812
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"