NovoPro
Cart 2
  • Bin1 Rat  cDNA/ORF Clones

Bin1 Rat cDNA/ORF Clones

Cat.#: 742686-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 245.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    bridging integrator 1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Bin1
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Amph2; amphiphysin II; amphiphysin IIamph2; amphiphysin-like protein; myc box dependent interacting protein 1
  • Product Name
    Bin1(XM_006254503) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1434
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254500) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1503
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254498) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1641
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254504) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1305
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254496) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1815
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_017600831) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1401
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_008772014) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1350
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254505) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1233
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_017600830) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1530
  • siRNA
  • DataSheet:
  • Product Name
    Bin1(XM_006254501) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1479
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254502) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1446
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(NM_053959) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus bridging integrator 1 (Bin1), mRNA.
  • Synonyms
    XM_346509  
  • ORF length
    1767
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254499) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1575
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_006254497) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1674
  • siRNA

    GCACCACUAUGAGUCUCUUtt

    GCCUUUUUGAUGACGCAUUtt

    CGAACAAGAUAGCAGAGAAtt

  • DataSheet:
  • Product Name
    Bin1(XM_017600832) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus bridging integrator 1 (Bin1), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    1278
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"