Cart 2
  • Bckdhb Mouse  cDNA/ORF Clone

Bckdhb Mouse cDNA/ORF Clone

Cat.#: 749696-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    branched chain ketoacid dehydrogenase E1, beta polypeptide
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Bckdhb
  • Gene Type
    protein coding
  • Also Known as
    BCKDE1B; BCKDH E1-beta
  • Encoded Protein Alias
    branched-chain alpha-keto acid dehydrogenase E1 component beta chain
  • Product Name
    Bckdhb(NM_199195) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus branched chain ketoacid dehydrogenase E1, beta polypeptide (Bckdhb), transcript variant 2, mRNA.
  • Synonyms
    XM_135013  
  • ORF length
    969
  • Annotation
    This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.
  • siRNA

    GCACUGUUGGUUUACGAGAtt

    CGAGUUUGCGGAUAUGACAtt

    CAGCUAUUGCGGAAAUCCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Bckdhb(NM_001305935) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus branched chain ketoacid dehydrogenase E1, beta polypeptide (Bckdhb), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1173
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA
  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"