NovoPro
Cart 2
  • BCS1L Human  cDNA/ORF Clone

BCS1L Human cDNA/ORF Clone

Cat.#: 714793-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 154.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BCS1L
  • Gene Type
    protein coding
  • Also Known as
    BCS; BJS; PTD; BCS1; FLNMS; h-BCS; MC3DN1; h-BCS1; GRACILE; Hs.6719
  • Encoded Protein Alias
    mitochondrial chaperone BCS1; BCS1-like protein; h-BCS1; mitochondrial complex III assembly
  • Product Name
    BCS1L(NM_001318836) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone (BCS1L), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    900
  • Annotation
    This variant (6) lacks two alternate exons compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a.
  • siRNA

    GUCCAGGAAUUCAUCGAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"