NovoPro
Cart 2
  • BAIAP2 Human  cDNA/ORF Clones

BAIAP2 Human cDNA/ORF Clones

Cat.#: 710787-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 217.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BAI1 associated protein 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BAIAP2
  • Gene Type
    protein coding
  • Also Known as
    BAP2; FLAF3; IRSP53
  • Encoded Protein Alias
    brain-specific angiogenesis inhibitor 1-associated protein 2; IRS-58; IRSp53/58; fas ligand-associated factor 3; insulin receptor substrate p53/p58; insulin receptor substrate protein of 53 kDa
  • Product Name
    BAIAP2(XM_005256948) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1569
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(I3L4C2) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1662
  • siRNA
  • DataSheet:
  • Product Name
    BAIAP2(XM_011524194) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1707
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_006721637) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1608
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_017024018) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1374
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_006721635) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1668
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_006721636) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1665
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(NM_017450) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1566
  • Annotation
    This variant (1) shares identical sequence with variants 2, 3 and 4, but diverges after amino acid 511 resulting in a distinct 10 amino acid sequence at the C-terminus. This transcript variant is alternatively referred to as BAP2-alpha, short form, or variant S.
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(NM_017451) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1659
  • Annotation
    This variant (2) shares identical sequence with variants 1, 3 and 4, but diverges after amino acid 511 resulting in a distinct 41 amino acid sequence at the C-terminus. This transcript variant is alternatively referred to as the long form or variant L.
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(NM_001144888) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1605
  • Annotation
    This variant (4) shares identical sequence with variants 1, 2 and 3, but diverges after amino acid 511 resulting in a distinct 23 amino acid sequence at the C-terminus. This transcript variant is alternatively referred to as variant M.
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_005256944) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1665
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_005256943) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1704
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_011524197) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    876
  • siRNA

    AGACCGCACUGACAGAGGAtt

  • DataSheet:
  • Product Name
    BAIAP2(XM_017024017) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1590
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Product Name
    BAIAP2(NM_006340) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BAI1 associated protein 2 (BAIAP2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1563
  • Annotation
    This variant (3) shares identical sequence with variants 1, 2 and 4, but diverges after amino acid 511 resulting in a distinct 9 amino acid sequence at the C-terminus. This transcript variant is alternatively referred to as BAP2-beta or variant T.
  • siRNA

    AGACCGCACUGACAGAGGAtt

    AGAAGUACUCGGACAAGGAtt

    CAGAAUCAGCUGGAAGAAAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"