NovoPro
Cart 2
  • ASTN2 Human  cDNA/ORF Clones

ASTN2 Human cDNA/ORF Clones

Cat.#: 716765-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    astrotactin 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ASTN2
  • Gene Type
    protein coding
  • Also Known as
    bA67K19.1
  • Encoded Protein Alias
    bA264C15.1
  • Product Name
    ASTN2(NM_198186) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens astrotactin 2 (ASTN2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1323
  • Annotation
    This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.
  • siRNA

    GAGAUUCGCUGUGAGGAGAtt

    GGCAUGGUGUGGUAUAGCAtt

    CCACUACAACUCUCACUAUtt

    CUACAACUCUCACUAUGAAtt

  • DataSheet:
  • Product Name
    ASTN2(NM_014010) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens astrotactin 2 (ASTN2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3867
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    GAGAUUCGCUGUGAGGAGAtt

    GGCAUGGUGUGGUAUAGCAtt

    CCACUACAACUCUCACUAUtt

    CUACAACUCUCACUAUGAAtt

  • DataSheet:
  • Product Name
    ASTN2(NM_001184735) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens astrotactin 2 (ASTN2), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    585
  • Annotation
    This variant (6) has multiple differences compared to variant 1. These differences result in a distinct 5' UTR and lead to translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (f) has distinct N- and C-termini and is shorter than isoform a.
  • siRNA

    GAGAUUCGCUGUGAGGAGAtt

  • DataSheet:
  • Product Name
    ASTN2(NM_198187) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens astrotactin 2 (ASTN2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1209
  • Annotation
    This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks a segment in the 3' coding region compared to variant 1. The encoded isoform (c) has distinct N- and C-termini and is shorter than isoform a.
  • siRNA

    GAGAUUCGCUGUGAGGAGAtt

    GGCAUGGUGUGGUAUAGCAtt

    CCACUACAACUCUCACUAUtt

    CUACAACUCUCACUAUGAAtt

  • DataSheet:
  • Product Name
    ASTN2(NM_198188) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens astrotactin 2 (ASTN2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1188
  • Annotation
    This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks a segment in the 3' coding region compared to variant 1. The encoded isoform (d) has distinct N- and C-termini and is shorter than isoform a.
  • siRNA

    GAGAUUCGCUGUGAGGAGAtt

    GGCAUGGUGUGGUAUAGCAtt

    CCACUACAACUCUCACUAUtt

    CUACAACUCUCACUAUGAAtt

  • DataSheet:
  • Product Name
    ASTN2(NM_001184734) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens astrotactin 2 (ASTN2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1128
  • Annotation
    This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks a segment in the 3' coding region compared to variant 1. The encoded isoform (e) has distinct N- and C-termini and is shorter than isoform a.
  • siRNA

    GAGAUUCGCUGUGAGGAGAtt

    GGCAUGGUGUGGUAUAGCAtt

    CCACUACAACUCUCACUAUtt

    CUACAACUCUCACUAUGAAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"