NovoPro
Cart 2
  • Gas6 Mouse  cDNA/ORF Clones

Gas6 Mouse cDNA/ORF Clones

Cat.#: 715103-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 154.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    growth arrest specific 6
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Gas6
  • Gene Type
    protein coding
  • Also Known as
    Gas-6
  • Encoded Protein Alias
    AXL receptor tyrosine kinase ligand; GAS 6
  • Product Name
    Gas6(NM_019521) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus growth arrest specific 6 (Gas6), mRNA.
  • Synonyms
  • ORF length
    2025
  • siRNA

    GCUUCUCGCUUGCAUCAGAtt

    CGAUAUCAAGAGUGCAUGAtt

    GCAUGACUCUGGAGGUAAAtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"