NovoPro
Cart 2
  • APBB1 Human  cDNA/ORF Clones

APBB1 Human cDNA/ORF Clones

Cat.#: 714876-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 254.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    amyloid beta precursor protein binding family B member 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    APBB1
  • Gene Type
    protein coding
  • Also Known as
    RIR; FE65; MGC:9072
  • Encoded Protein Alias
    amyloid beta A4 precursor protein-binding family B member 1; adaptor protein FE65a2; stat-like protein
  • Product Name
    APBB1(NM_001257320) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1356
  • Annotation
    This variant (6) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (d) with a shorter N-terminus, compared to isoform 1. Variants 4, 5, and 6 all encode the same isoform (d).
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(NM_001164) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2133
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a, also known as E9). This isoform is exclusively expressed in neurons.
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_017017640) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    2142
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_011520042) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1761
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(NM_001257325) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1428
  • Annotation
    This variant (7) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (e) with a shorter and distinct N-terminus, compared to isoform 1.
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_011520038) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1644
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_006718215) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    2409
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_006718213) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2421
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(NM_001257319) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    1473
  • Annotation
    This variant (9) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (g) with a shorter and distinct N-terminus, compared to isoform 1.
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(NM_145689) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2127
  • Annotation
    This variant (2) differs in the 5' UTR and lacks an alternate, in-frame exon in the coding region compared to variant 1. This results in a protein that maintains the reading frame but is a shorter isoform (b, also known as delta E9), compared to isoform a. This encoded isoform (b) is widely expressed in all non-neuronal cells but is not expressed in differentiated neurons.
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_017017642) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1350
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_006718209) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2436
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(XM_017017639) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2148
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Product Name
    APBB1(NM_001257323) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1467
  • Annotation
    This variant (8) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region, and lacks an alternate, in-frame exon in the coding region compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (f) that is shorter with a distinct N-terminus, compared to isoform 1.
  • siRNA

    GGAUGAGACACUAAAGCUAtt

    GAAAGGAUCUGCUACUGCAtt

    GAAUGUACCUGUUGCUAAAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"