NovoPro
Cart 2
  • AOC1 Human  cDNA/ORF Clones

AOC1 Human cDNA/ORF Clones

Cat.#: 714973-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 433.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    amine oxidase, copper containing 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    AOC1
  • Gene Type
    protein coding
  • Also Known as
    ABP; DAO; KAO; ABP1; DAO1
  • Encoded Protein Alias
    amiloride-sensitive amine oxidase [copper-containing]; amiloride binding protein 1 (amine oxidase (copper-containing)); amiloride-binding protein 1; amiloride-sensitive amine oxidase; amine oxidase copper domain-containing protein 1; diamine oxidase; histaminase; kidney amine oxidase
  • Product Name
    AOC1(NM_001272072) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amine oxidase, copper containing 1 (AOC1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2313
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CCGUGUUUCUCAUCGAGAUtt

    CUUCAACUGUCUACAAUUAtt

    CGUGGUCUUUGAGCAGUUUtt

  • DataSheet:
  • Product Name
    AOC1(NM_001091) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens amine oxidase, copper containing 1 (AOC1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2256
  • Annotation
    This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • siRNA

    CCGUGUUUCUCAUCGAGAUtt

    CUUCAACUGUCUACAAUUAtt

    CGUGGUCUUUGAGCAGUUUtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"