NovoPro
Cart 2
  • ADGRE5 Human  cDNA/ORF Clone

ADGRE5 Human cDNA/ORF Clone

Cat.#: 714560-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 154.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    adhesion G protein-coupled receptor E5
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ADGRE5
  • Gene Type
    protein coding
  • Also Known as
    CD97; TM7LN1
  • Encoded Protein Alias
    CD97 antigen; CD97 molecule; leukocyte antigen CD97; seven transmembrane helix receptor; seven-span transmembrane protein; seven-transmembrane, heterodimeric receptor associated with inflammation
  • Product Name
    ADGRE5(NM_001784) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens adhesion G protein-coupled receptor E5 (ADGRE5), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2229
  • Annotation
    This variant (2) lacks two consecutive exons in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2, also known as CD97(EGF 1,2,5)) is shorter than isoform 1.
  • siRNA

    GGAGCUUCUUGGGACCUGUtt

    AAAUCAAUCCAGACAUGAAtt

    AGAAGGUUCGGGAAGAAUAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    ADGRE5(XM_011528451) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens adhesion G protein-coupled receptor E5 (ADGRE5), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2484
  • siRNA

    GGAGCUUCUUGGGACCUGUtt

    AAAUCAAUCCAGACAUGAAtt

    AGAAGGUUCGGGAAGAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ADGRE5(NM_078481) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens adhesion G protein-coupled receptor E5 (ADGRE5), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2508
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as CD97(EGF 1,2,3,4,5)).
  • siRNA

    GGAGCUUCUUGGGACCUGUtt

    AAAUCAAUCCAGACAUGAAtt

    AGAAGGUUCGGGAAGAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ADGRE5(NM_001025160) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens adhesion G protein-coupled receptor E5 (ADGRE5), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2361
  • Annotation
    This variant (3) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3, also known as CD97(EGF 1,2,3,5)) is shorter than isoform 1.
  • siRNA

    GGAGCUUCUUGGGACCUGUtt

    AAAUCAAUCCAGACAUGAAtt

    AGAAGGUUCGGGAAGAAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"