NovoPro
Cart 2
  • Ak4 Mouse  cDNA/ORF Clones

Ak4 Mouse cDNA/ORF Clones

Cat.#: 710327-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    adenylate kinase 4
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ak4
  • Gene Type
    protein coding
  • Also Known as
    Ak3; AK 4; Ak-3; Ak-4; Ak3l1; D4Ertd274e
  • Encoded Protein Alias
    adenylate kinase 4, mitochondrial; AK 4; ATP-AMP transphosphorylase; GTP:AMP phosphotransferase AK4, mitochondrial; adenylate kinase 3 alpha-like 1; adenylate kinase 3-like 1; adenylate kinase isoenzyme 4, mitochondrial
  • Product Name
    Ak4(XM_017319923) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus adenylate kinase 4 (Ak4), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    552
  • siRNA
  • DataSheet:
  • Product Name
    Ak4(NM_009647) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus adenylate kinase 4 (Ak4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    672
  • Annotation
    This variant (1) represents the longest transcript. Variants 1-4 encode the same protein.
  • siRNA

    CAAGGGAAAUGCUUACUUAtt

    AGAUGGUUGGGUGCAAGAAtt

    UAGUAGUAAUUGUAUGGAAtt

    GGCUAAGACGGUACAAGGAtt

    AACCAGUCAUCGAACUGUAtt

    GGACAUUAGUACAGGCAGAtt

  • DataSheet:
  • Product Name
    Ak4(XM_006502685) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus adenylate kinase 4 (Ak4), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    456
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"