NovoPro
Cart 2
  • ADAR Human  cDNA/ORF Clones

ADAR Human cDNA/ORF Clones

Cat.#: 714951-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 257.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    adenosine deaminase, RNA specific
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ADAR
  • Gene Type
    protein coding
  • Also Known as
    DSH; AGS6; G1P1; IFI4; P136; ADAR1; DRADA; DSRAD; IFI-4; K88DSRBP
  • Encoded Protein Alias
    double-stranded RNA-specific adenosine deaminase; 136 kDa double-stranded RNA-binding protein; RNA-specific adenosine deaminase; adenosine deaminase acting on RNA 1-A; dsRNA adenosine deaminase; interferon-induced protein 4; interferon-inducible protein 4
  • Product Name
    ADAR(NM_001111) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens adenosine deaminase, RNA specific (ADAR), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3681
  • Annotation
    This variant (1) encodes the longest isoform (a, also referred to as ADAR-a).
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    ADAR(XM_011509062) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens adenosine deaminase, RNA-specific (ADAR), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    3699
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Product Name
    ADAR(XM_006711109) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens adenosine deaminase, RNA-specific (ADAR), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    3711
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Product Name
    ADAR(XM_011509061) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens adenosine deaminase, RNA-specific (ADAR), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2718
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Product Name
    ADAR(NM_015840) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens adenosine deaminase, RNA specific (ADAR), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3603
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (b, also referred to as ADAR-b) that is shorter than isoform a. There are no publicly available full-length transcripts representing this variant; it is represented based on data in PMID:9020165 and annotation on DNA accession U75503.1.
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Product Name
    ADAR(NM_001193495) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens adenosine deaminase, RNA specific (ADAR), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2796
  • Annotation
    This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The resulting isoform (d) is shorter at the N-terminus, compared to isoform a. Both variants 4 and 5 encode the same isoform.
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Product Name
    ADAR(NM_015841) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens adenosine deaminase, RNA specific (ADAR), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    3546
  • Annotation
    This variant (3) uses two alternate in-frame splice sites in the central coding region, compared to variant 1, resulting in an isoform (c, also referred to as ADAR-c) that is shorter than isoform a. There are no publicly available full-length transcripts representing this variant; it is represented based on data in PMID:9020165 and annotation on DNA accession U75503.1.
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Product Name
    ADAR(XM_011509060) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens adenosine deaminase, RNA-specific (ADAR), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3810
  • siRNA

    CAGUGUUCCUGAAACCGCUtt

    GAGAUUCUCUCAGCCUAAAtt

    GGCAAUCCGGGAAGACUAAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"