NovoPro
Cart 2
  • Gsn Mouse  cDNA/ORF Clones

Gsn Mouse cDNA/ORF Clones

Cat.#: 715672-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 376.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    gelsolin
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Gsn
  • Gene Type
    protein coding
  • Also Known as
    ADF
  • Encoded Protein Alias
    actin-depolymerizing factor; brevin
  • Product Name
    Gsn(NM_001206369) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus gelsolin (Gsn), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2196
  • Annotation
    This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2, 3 and 4 encode the same isoform (2).
  • siRNA

    CUGUGCAACUGGAUGACUAtt

    GCAACAAAUUUGAAAGGCUtt

    ACAUCAUUCUGUACAACUAtt

  • DataSheet:
  • Product Name
    Gsn(NM_146120) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus gelsolin (Gsn), transcript variant 1, mRNA.
  • Synonyms
    NM_010354  
  • ORF length
    2343
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (1).
  • siRNA

    CUGUGCAACUGGAUGACUAtt

    GCAACAAAUUUGAAAGGCUtt

    ACAUCAUUCUGUACAACUAtt

  • DataSheet:
  • Product Name
    Gsn(XM_006497990) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus gelsolin (Gsn), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2409
  • siRNA
  • DataSheet:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"