NovoPro
Cart 2
  • ABL1 Human  cDNA/ORF Clones

ABL1 Human cDNA/ORF Clones

Cat.#: 714961-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 814.3 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ABL proto-oncogene 1, non-receptor tyrosine kinase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ABL1
  • Gene Type
    protein coding
  • Also Known as
    ABL; JTK7; p150; c-ABL; v-abl; c-ABL1; bcr/abl
  • Encoded Protein Alias
    tyrosine-protein kinase ABL1; Abelson tyrosine-protein kinase 1; bcr/c-abl oncogene protein; c-abl oncogene 1, receptor tyrosine kinase; proto-oncogene c-Abl; proto-oncogene tyrosine-protein kinase ABL1; v-abl Abelson murine leukemia viral oncogene homolog 1
  • Product Name
    ABL1(NM_005157) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens ABL proto-oncogene 1, non-receptor tyrosine kinase (ABL1), transcript variant a, mRNA.
  • Synonyms
  • ORF length
    3393
  • Annotation
    This variant (a) includes an alternate 5' terminal exon (exon 1a instead of exon 1b), and it thus differs in the 5' UTR and 5' coding region, compared to variant b. The encoded isoform (a), which is localized in the nucleus, has a distinct N-terminus and is shorter than isoform b.
  • siRNA

    GAAGGGAGGGUGUACCAUUtt

    CGACAAGUGGGAGAUGGAAtt

    CACUCUAAGCAUAACUAAAtt

  • DataSheet:
  • Product Name
    ABL1(NM_007313) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens ABL proto-oncogene 1, non-receptor tyrosine kinase (ABL1), transcript variant b, mRNA.
  • Synonyms
  • ORF length
    3450
  • Annotation
    This variant (b), which includes exon 1b but not exon 1a, represents the longer transcript and encodes the longer isoform (b). This isoform contains an N-terminal glycine which could be myristylated, and it is thus thought to be directed to the plasma membrane.
  • siRNA

    GAAGGGAGGGUGUACCAUUtt

    CGACAAGUGGGAGAUGGAAtt

    CACUCUAAGCAUAACUAAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"