Basic Vector Information
- Vector Name:
- BASU RaPID plasmid
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12356 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- CGC AAA TGG GCG GTA GGC GTG
- 3' Primer:
- atatagacaaacgcacaccggcct
BASU RaPID plasmid vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
BASU RaPID plasmid vector Sequence
LOCUS V007044 12356 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V007044 VERSION V007044 KEYWORDS BASU RaPID plasmid. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 12356) AUTHORS Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S, Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE, Khavari PA TITLE RNA-protein interaction detection in living cells. JOURNAL Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601. PUBMED 29400715 REFERENCE 2 (bases 1 to 12356) TITLE Direct Submission REFERENCE 3 (bases 1 to 12356) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601." SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..12356 /mol_type="other DNA" /organism="synthetic DNA construct" LTR 1..634 /label="3' LTR" /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 681..806 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1303..1536 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1721..1765 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1914..1955 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2063..2180 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" CDS complement(2248..2619) /label="BleoR" /note="antibiotic-binding protein" promoter complement(2639..2686) /label="EM7 promoter" /note="synthetic bacterial promoter" enhancer 2791..3094 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 3095..3298 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" primer_bind 3295..3319 /label="LNCX" /note="Human CMV promoter, forward primer" CDS 3492..3518 /label="NES" /note="nuclear export signal from the HIV Rev protein (Fischer et al., 1995)" CDS 3528..3554 /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" misc_feature 4358..4940 /label="IRES2" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 4939..5532 /label="PuroR" /note="puromycin N-acetyltransferase" CDS 5542..5595 /codon_start=1 /product="2A peptide from Thosea asigna virus capsid protein" /label="T2A" /note="Eukaryotic ribosomes fail to insert a peptide bond between the Gly and Pro residues, yielding separate polypeptides." /translation="EGRGSLLTCGDVEENPGP" CDS 5608..6315 /label="mCherry" /note="monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)" misc_feature 6331..6919 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 7126..7359 /label="3' LTR (Delta-U3)" /note="self-inactivating 3' long terminal repeat (LTR) from HIV-1" polyA_signal 7466..7690 /label="bGH poly(A) signal" /note="bovine growth hormone polyadenylation signal" rep_origin 7736..8164 /label="f1 ori" /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 8178..8507 /label="SV40 promoter" /note="SV40 enhancer and early promoter" CDS 8556..9578 /label="HygR" /note="aminoglycoside phosphotransferase from E. coli" polyA_signal 9711..9844 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" primer_bind complement(9881..9897) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" primer_bind complement(9881..9897) /label="M13 Reverse" /note="In lacZ gene. Also called M13-rev" primer_bind complement(9894..9916) /label="M13/pUC Reverse" /note="In lacZ gene" protein_bind 9905..9921 /label="lac operator" /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(9929..9959) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(9974..9995) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." primer_bind complement(10112..10129) /label="L4440" /note="L4440 vector, forward primer" rep_origin complement(10283..10871) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(11045..11902) /label="AmpR" /note="beta-lactamase" promoter complement(11903..12007) /label="AmpR promoter" polyA_signal 12055..12189 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal"
This page is informational only.