CHOP promoter (-649/+136) pmCherry-1 vector (V012177)

MSDS

Basic Vector Information

Vector Name:: CHOP promoter (-649/+136) pmCherry-1

Antibiotic Resistance:: Kanamycin

Length:: 4880 bp

Type:: Mammalian Expression

Replication origin:: ori

Selection Marker:: Neomycin (select with G418)

Copy Number:: High Copy

Promoter:: SV40

Cloning Method:: Restriction Enzyme

5' Primer:: custom: GGCCTTTTGCTCACATGTTC

CHOP promoter (-649/+136) pmCherry-1 vector Vector Map

View Map in NovoBuilder

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

CHOP promoter (-649/+136) pmCherry-1 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V012177                 4880 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012177
VERSION     V012177
KEYWORDS    CHOP promoter (-649/+136) pmCherry-1.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 4880)
  AUTHORS   Oh RS, Pan WC, Yalcin A, Zhang H, Guilarte TR, Hotamisligil GS,
            Christiani DC, Lu Q
  TITLE     Functional RNA Interference (RNAi) Screen Identifies System A
            Neutral Amino Acid Transporter 2 (SNAT2) as a Mediator of
            Arsenic-induced Endoplasmic Reticulum Stress.
  JOURNAL   J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3.
   PUBMED   22215663
REFERENCE   2  (bases 1 to 4880)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 4880)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "J Biol
            Chem."; date: "2012-02-17"; volume: "287(8)"; pages: "6025-34. Epub
            2012 Jan 3"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..4880
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             711..812
                     /gene="DDIT3"
                     /label="DDIT3 upstream open reading frame protein"
                     /note="DDIT3 upstream open reading frame protein from Homo
                     sapiens. Accession#: P0DPQ6"
     CDS             837..1544
                     /label="mCherry"
                     /note="monomeric derivative of DsRed fluorescent protein
                     (Shaner et al., 2004)"
     polyA_signal    1668..1789
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1796..2251)
                     /direction=LEFT
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2278..2382
                     /label="AmpR promoter"
     promoter        2384..2741
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             2776..3567
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     primer_bind     complement(3758..3777)
                     /label="TK-pA-R"
                     /note="Thymidine kinase polyA, reverse primer"
     polyA_signal    3802..3849
                     /label="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      4178..4766
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"

This page is informational only.