Basic Vector Information
- Vector Name:
- ER50-SpCas9-ER50
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10000 bp
- Type:
- Mammalian Expression, AAV
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CBh
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- agcgaagcgcgcggcgggcg
- 3' Primer:
- TAGAAGGCACAGTCGAGG
ER50-SpCas9-ER50 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
ER50-SpCas9-ER50 vector Sequence
LOCUS V012207 10000 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V012207 VERSION V012207 KEYWORDS ER50-SpCas9-ER50. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 10000) AUTHORS Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A TITLE Multidimensional chemical control of CRISPR-Cas9. JOURNAL Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. PUBMED 27820801 REFERENCE 2 (bases 1 to 10000) TITLE Direct Submission REFERENCE 3 (bases 1 to 10000) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1038/nchembio.2224"; journalName: "Nat Chem Biol"; date: "2017-01"; volume: "13"; issue: "1"; pages: "9-11" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..10000 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 1..241 /label="U6 promoter" /note="RNA polymerase III promoter for human U6 snRNA" misc_RNA 268..343 /label="gRNA scaffold" /note="guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system" enhancer 440..725 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer; contains an 18-bp deletion relative to the standard CMV enhancer" promoter 727..1004 /label="chicken beta-actin promoter" intron 1005..1233 /label="hybrid intron" /note="hybrid between chicken beta-actin (CBA) and minute virus of mice (MMV) introns (Gray et al., 2011)" regulatory 1245..1254 /label="Kozak sequence" /note="vertebrate consensus sequence for strong initiation of translation (Kozak, 1987)" /regulatory_class="other" CDS 1254..1319 /label="3xFLAG" /note="three tandem FLAG(R) epitope tags, followed by an enterokinase cleavage site" CDS 1326..1346 /label="SV40 NLS" /note="nuclear localization signal of SV40 (simian virus 40) large T antigen" CDS 1671..2033 /gene="ESR1" /label="Estrogen receptor" /note="Estrogen receptor from Macaca mulatta. Accession#: P49886" CDS 2130..6230 /label="Cas9" /note="Cas9 (Csn1) endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system" CDS 6231..6278 /codon_start=1 /product="bipartite nuclear localization signal from nucleoplasmin" /label="nucleoplasmin NLS" /translation="KRPAATKKAGQAKKKK" polyA_signal 7047..7254 /label="bGH poly(A) signal" /note="bovine growth hormone polyadenylation signal" repeat_region 7263..7403 /label="AAV2 ITR" /note="inverted terminal repeat of adeno-associated virus serotype 2" rep_origin 7478..7933 /label="f1 ori" /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" primer_bind complement(7950..7969) /label="pRS-marker" /note="pRS vectors, use to sequence yeast selectable marker" primer_bind 8069..8091 /label="pGEX 3'" /note="pGEX vectors, reverse primer" primer_bind complement(8129..8147) /label="pBRforEco" /note="pBR322 vectors, upsteam of EcoRI site, forward primer" promoter 8215..8319 /label="AmpR promoter" CDS 8320..9177 /label="AmpR" /note="beta-lactamase" rep_origin 9351..9939 /direction=RIGHT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication"
This page is informational only.