Basic Vector Information
- Vector Name:
- AAVS1-Blasticidin-CAG-Flpe-ERT2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12382 bp
- Type:
- Mammalian Expression, Synthetic Biology
- Replication origin:
- ori
- Selection Marker:
- Blasticidin
- Copy Number:
- High Copy
- Promoter:
- CAG
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- ggcttctggcgtgtgaccggc
- 3' Primer:
- catagcgtaaaaggagcaaca
AAVS1-Blasticidin-CAG-Flpe-ERT2 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
AAVS1-Blasticidin-CAG-Flpe-ERT2 vector Sequence
LOCUS V010517 12382 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V010517 VERSION V010517 KEYWORDS AAVS1-Blasticidin-CAG-Flpe-ERT2. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 12382) AUTHORS Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC TITLE Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. JOURNAL Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. PUBMED 26145478 REFERENCE 2 (bases 1 to 12382) TITLE Direct Submission REFERENCE 3 (bases 1 to 12382) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001." SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..12382 /mol_type="other DNA" /organism="synthetic DNA construct" misc_feature 33..836 /label="HA-L" /note="left homology arm from the adeno-associated virus integration site (AAVS1) within intron 1 of the human PPP1R12C gene" misc_feature 843..868 /label="SA" /note="splice acceptor site" CDS 892..945 /label="T2A" /note="2A peptide from Thosea asigna virus capsid protein" CDS 955..1374 /gene="bsr" /label="Blasticidin-S deaminase" /note="Blasticidin-S deaminase from Bacillus cereus. Accession#: P33967" polyA_signal 1424..1648 /label="bGH poly(A) signal" /note="bovine growth hormone polyadenylation signal" enhancer 1716..2095 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 2097..2374 /label="chicken beta-actin promoter" intron 2376..3393 /label="chimeric intron" /note="chimera between introns from chicken beta-actin and rabbit beta-globin" primer_bind 3401..3420 /label="pCAG-F" /note="Rabbit beta-globin intron, for pCAG plasmids, forward primer" regulatory 3457..3466 /label="Kozak sequence" /note="vertebrate consensus sequence for strong initiation of translation (Kozak, 1987)" /regulatory_class="other" CDS 3469..4737 /label="FLPo" /note="nuclear-targeted site-specific recombinase" CDS 4762..5697 /label="ERT2" /note="mutated ligand-binding domain of the human estrogen receptor (Feil et al., 1997)" misc_feature 5737..6325 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" polyA_signal 6357..6833 /label="hGH poly(A) signal" /note="human growth hormone polyadenylation signal" primer_bind complement(6943..6962) /label="Bglob-pA-R" /note="Rabbit beta-globin polyA region, reverse primer" polyA_signal 7008..7063 /label="beta-globin poly(A) signal" /note="rabbit beta-globin polyadenylation signal (Gil and Proudfoot, 1987)" primer_bind complement(7062..7081) /label="rbglobpA-R" /note="Rabbit beta-globin polyA, reverse primer. Also called rb-glob-pA-term-R" primer_bind complement(7424..7440) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" protein_bind 7448..7464 /label="lac operator" /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(7472..7502) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(7517..7538) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." misc_feature 7612..8448 /label="HA-R" /note="right homology arm from the adeno-associated virus integration site (AAVS1) within intron 1 of the human PPP1R12C gene" promoter complement(8489..8507) /label="T7 promoter" /note="promoter for bacteriophage T7 RNA polymerase" primer_bind complement(8514..8531) /label="M13 Forward" /note="In lacZ gene. Also called M13-F20 or M13 (-21) Forward" primer_bind complement(8514..8530) /label="M13 fwd" /note="common sequencing primer, one of multiple similar variants" primer_bind complement(8523..8545) /label="M13/pUC Forward" /note="In lacZ gene" CDS 8668..8967 /label="ccdB" /note="CcdB, a bacterial toxin that poisons DNA gyrase" primer_bind complement(9373..9392) /label="Neo-R" /note="Neomycin resistance gene, reverse primer" primer_bind 9987..10006 /label="Neo-F" /note="Neomycin resistance gene, forward primer" CDS complement(10370..11227) /label="AmpR" /note="beta-lactamase" rep_origin 11351..11939 /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" primer_bind 12093..12110 /label="L4440" /note="L4440 vector, forward primer" protein_bind 12227..12248 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 12263..12293 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 12301..12317 /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." primer_bind 12325..12341 /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" promoter 12362..12380 /label="T3 promoter" /note="promoter for bacteriophage T3 RNA polymerase"
This page is informational only.