Basic Vector Information
- Vector Name:
- Cre-IRES-PuroR
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9229 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GGTTCATTCTCAAGCCTCAGACAGTG
Cre-IRES-PuroR vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
Cre-IRES-PuroR vector Sequence
LOCUS V001194 9229 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V001194 VERSION V001194 KEYWORDS Cre-IRES-PuroR. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 9229) AUTHORS Somers A, Jean JC, Sommer CA, Omari A, Ford CC, Mills JA, Ying L, Sommer AG, Jean JM, Smith BW, Lafyatis R, Demierre MF, Weiss DJ, French DL, Gadue P, Murphy GJ, Mostoslavsky G, Kotton DN TITLE Generation of transgene-free lung disease-specific human induced pluripotent stem cells using a single excisable lentiviral stem cell cassette. JOURNAL Stem Cells. 2010 Oct . 28(10):1728-40. PUBMED 20715179 REFERENCE 2 (bases 1 to 9229) TITLE Direct Submission REFERENCE 3 (bases 1 to 9229) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Stem Cells. 2010 Oct . 28(10):1728-40." SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..9229 /mol_type="other DNA" /organism="synthetic DNA construct" primer_bind 55..74 /label="EBV-rev" /note="SV40 polyA terminator, reverse primer" LTR 266..899 /label="3' LTR" /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 946..1071 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1568..1801 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1986..2030 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 2179..2220 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2323..2440 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 2488..3666 /label="EF-1-alpha promoter" /note="strong constitutive promoter for human elongation factor EF-1-alpha" regulatory 3671..3680 /label="Kozak sequence" /note="vertebrate consensus sequence for strong initiation of translation (Kozak, 1987)" /regulatory_class="other" CDS 3707..4735 /label="Cre" /note="site-specific recombinase" misc_feature 4741..5319 /label="IRES2" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 5323..5919 /label="PuroR" /note="puromycin N-acetyltransferase" misc_feature 5936..6524 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 6672..6852 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" primer_bind complement(6899..6917) /label="pBRforEco" /note="pBR322 vectors, upsteam of EcoRI site, forward primer" promoter 6985..7089 /label="AmpR promoter" CDS 7090..7947 /label="AmpR" /note="beta-lactamase" rep_origin 8121..8709 /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" primer_bind 8863..8880 /label="L4440" /note="L4440 vector, forward primer" primer_bind 8972..8991 /label="SV40pro-F" /note="SV40 promoter/origin, forward primer" protein_bind 9120..9141 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 9156..9186 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 9194..9210 /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)."
This page is informational only.